Review



cd16 g7 pig igg1  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier
Bioz Manufacturer Symbol Bio-Rad manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Bio-Rad cd16 g7 pig igg1
    Cd16 G7 Pig Igg1, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 52 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd16+g7+pig+igg1/Mouse+anti+Pig+CD16/pmc11199589__41598_2024_64497_MOESM1_ESM-1-19-25
    Average 93 stars, based on 52 article reviews
    cd16 g7 pig igg1 - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Purification:

    Article Title: Acute Ascaris infection impairs the effector functions of natural killer cells in single and Salmonella co-infected pigs
    Article Snippet: .. Clone Reactive species Isotype Dilution Fluorochrome Source company CD8a 76-2-11 Pig IgG2a 1:100 Purified- (Rat-anti mouse Ig2a PE-Cy7-) Biolegend CD16 G7 Pig IgG1 1:20 FITC Bio-Rad CD107a 4E9/11 Pig IgG1 1:20 A647 Bio-Rad CD3 BB23-8E6-8C8 Pig IgG2a 1:100 Streptavidin-Alexa700 ThermoFisher IFN-γ P2G10 Pig IgG1 1:100 PerCp-Cy5.5 ThermoFisher TNF-α Mab11 Human (Cross- reactive to pig) IgG1 1:100 APC-Cy7 Biolegend Perforin δG9 Human (Cross- reactive to pig) IgG2b 1:50 efluor 450 ThermoFisher T-bet 4B10 Human (Cross- reactive to pig) IgG1 1:100 BV605 Violet A EOMES WD1928 Human (Cross- reactive to pig) IgG1 1:50 PE ThermoFisher Accession number Target Sequence EU282355.1 NKp30 F: TCTATTACCAGGGCAAATGTGAAGT R: GTCACTGGGGTCTAGAATCACTCAT NM_001123143 NKp46 F: CCTTTGACCAGGAGCTTCACA R: AGATGTTTTGGCTCCTACAACAAG XM_003135179.3 CXCR3 F: CCGACCACAAGCACCAAAGCA R: TGGCGTTGGCTCATCTCAGGGA XM_021091173.1 KLRA1 (Ly49) F: TGGCAAGACTGATGAAAAAGAGTT R: GAAACAGAGGATCCCAAGAATCAC XM_021092358.1 KLRC1 (NKG2A) F: GTAATTGTCCAAAGGAATGGTTTACA R: CGAAGTAGAGTAGAATTCCGTGAAGC Supplementary Figure 1: Gating strategy used for the phenotyping of porcine NK cells. ..

    Sequencing:

    Article Title: Acute Ascaris infection impairs the effector functions of natural killer cells in single and Salmonella co-infected pigs
    Article Snippet: .. Clone Reactive species Isotype Dilution Fluorochrome Source company CD8a 76-2-11 Pig IgG2a 1:100 Purified- (Rat-anti mouse Ig2a PE-Cy7-) Biolegend CD16 G7 Pig IgG1 1:20 FITC Bio-Rad CD107a 4E9/11 Pig IgG1 1:20 A647 Bio-Rad CD3 BB23-8E6-8C8 Pig IgG2a 1:100 Streptavidin-Alexa700 ThermoFisher IFN-γ P2G10 Pig IgG1 1:100 PerCp-Cy5.5 ThermoFisher TNF-α Mab11 Human (Cross- reactive to pig) IgG1 1:100 APC-Cy7 Biolegend Perforin δG9 Human (Cross- reactive to pig) IgG2b 1:50 efluor 450 ThermoFisher T-bet 4B10 Human (Cross- reactive to pig) IgG1 1:100 BV605 Violet A EOMES WD1928 Human (Cross- reactive to pig) IgG1 1:50 PE ThermoFisher Accession number Target Sequence EU282355.1 NKp30 F: TCTATTACCAGGGCAAATGTGAAGT R: GTCACTGGGGTCTAGAATCACTCAT NM_001123143 NKp46 F: CCTTTGACCAGGAGCTTCACA R: AGATGTTTTGGCTCCTACAACAAG XM_003135179.3 CXCR3 F: CCGACCACAAGCACCAAAGCA R: TGGCGTTGGCTCATCTCAGGGA XM_021091173.1 KLRA1 (Ly49) F: TGGCAAGACTGATGAAAAAGAGTT R: GAAACAGAGGATCCCAAGAATCAC XM_021092358.1 KLRC1 (NKG2A) F: GTAATTGTCCAAAGGAATGGTTTACA R: CGAAGTAGAGTAGAATTCCGTGAAGC Supplementary Figure 1: Gating strategy used for the phenotyping of porcine NK cells. ..



    Similar Products

    cd16 g7 pig igg1  (Bio-Rad)
    93
    Bio-Rad cd16 g7 pig igg1
    Cd16 G7 Pig Igg1, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd16+g7+pig+igg1/Mouse+anti+Pig+CD16/pmc11199589__41598_2024_64497_MOESM1_ESM-1-19-25
    Average 93 stars, based on 1 article reviews
    cd16 g7 pig igg1 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    anti swcd16 bio rad mca1971ga g7 igg1  (Bio-Rad)
    93
    Bio-Rad anti swcd16 bio rad mca1971ga g7 igg1
    Anti Swcd16 Bio Rad Mca1971ga G7 Igg1, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd16+g7+pig+igg1/Mouse+anti+Pig+CD16/pmc10628533__DataSheet_1-85-52-53
    Average 93 stars, based on 1 article reviews
    anti swcd16 bio rad mca1971ga g7 igg1 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    goat igg1 cd16 pe abdserotec mca1971pe g7 pig igg1 th  (Bio-Rad)
    93
    Bio-Rad goat igg1 cd16 pe abdserotec mca1971pe g7 pig igg1 th
    Goat Igg1 Cd16 Pe Abdserotec Mca1971pe G7 Pig Igg1 Th, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd16+g7+pig+igg1/Mouse+anti+Pig+CD16/pmc07019005__Data_Sheet_1-10-14-18
    Average 93 stars, based on 1 article reviews
    goat igg1 cd16 pe abdserotec mca1971pe g7 pig igg1 th - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    j dako f 0844 fitc tûk4 cd16 pig igg1 serotec mca1971pe pe g7 cd18 pig igg1 serotec mca1972pe pe pnk  (Bio-Rad)
    93
    Bio-Rad j dako f 0844 fitc tûk4 cd16 pig igg1 serotec mca1971pe pe g7 cd18 pig igg1 serotec mca1972pe pe pnk
    J Dako F 0844 Fitc Tûk4 Cd16 Pig Igg1 Serotec Mca1971pe Pe G7 Cd18 Pig Igg1 Serotec Mca1972pe Pe Pnk, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd16+g7+pig+igg1/Mouse+anti+Pig+CD16/pm18782273-72-33-42
    Average 93 stars, based on 1 article reviews
    j dako f 0844 fitc tûk4 cd16 pig igg1 serotec mca1971pe pe g7 cd18 pig igg1 serotec mca1972pe pe pnk - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier

    Image Search Results